ROUGE |
Gene/Protein Characteristic Table for mKIAA1643 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129414 |
---|---|
mbh04344 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3980 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1075 bp Genome contig ID gi65498774r_32583233 PolyA signal sequence
(CATAAA,-22) +----*----+----*----+----*----+----
TCAAAACCATTTCCATAAATCTATTTAAGGATTGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACACGCTCTGGCGTCTTCTATGAACACCGAGTCCTTGACTTTGTTGTGTA
KIAA Alignment based on: KIAA1643 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 53..2905
Length: 950 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000306 | 875 | 941 | PF01363 | Zinc finger |
HMMSmart | IPR000306 | 872 | 941 | SM00064 | Zinc finger |
ProfileScan | IPR000306 | 880 | 936 | PS50178 | Zinc finger |
ScanRegExp | IPR000425 | 640 | 648 | PS00221 | Major intrinsic protein |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |