ROUGE |
Gene/Protein Characteristic Table for mKIAA4212 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK046633 |
---|---|
RUN and FYVE domain containing 1. FYVE-finger containing protein. Rab4a interacting protein. |
|
mbg08227 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2331 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 526 bp Genome contig ID gi65527427r_50042131 PolyA signal sequence
(AATAAA,-34) +----*----+----*----+----*----+----
CAATAAAATCCTTTATTTTTCACTCTTGTACAGACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAGTGCTGGCCTCCAGCTTGCTTGTGGAGGGCTCAGCAAGGCCTGGGGA
Features of the protein sequence |
Description | |
Coding region: 3..1802
Length: 600 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004012 | 39 | 163 | PF02759 | RUN |
IPR000306 | 529 | 593 | PF01363 | Zinc finger | |
HMMSmart | IPR000306 | 526 | 593 | SM00064 | Zinc finger |
ProfileScan | IPR004012 | 31 | 163 | PS50826 | RUN |
IPR000306 | 534 | 592 | PS50178 | Zinc finger |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |