Gene/Protein Characteristic Table for mKIAA1255

Length: 4958 bp

Restriction map

Length of 3'UTR	4426 bp
Genome contig ID	gi65527427f_72385897
PolyA signal sequence (AATAAA,-10)	+----*----+----*----+----*----+---- GTACTTACATATAATAATAAAAATAAATAAAATTT
Flanking genome sequence (111835 - 111884)	----+----*----+----*----+----*----+----*----+----* AAAAAAAATCTGGTTCATAAAGCCCTGATCAAGTCTAGTACCAAAAATAA

KIAA	Alignment based on:
KIAA1255	DNA sequence, AA sequence, Physical map

Coding region: 2..532

Length: 176 aa

Entry Exp ID% Protein Source EDM05121 4.9e-78 100.0 ankyrin repeat ... Rattus norvegicus EDL12695 5.2e-78 100.0 ankyrin repeat ... Mus musculus EDM05122 6.4e-78 100.0 ankyrin repeat ... Rattus norvegicus BAC67389 7e-78 100.0 ankyrin repeat ... Mus musculus Q810B6 7e-78 100.0 Ankyrin repeat ... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129414 1.2e-08 38.8 mKIAA1643 AB093277 2.8e-08 32.7 mKIAA0993 AK046633 1.8e-07 39.7 mKIAA4212 AK173195 1.8e-07 43.1 mKIAA1537 AK122241 7.4e-07 38.8 mKIAA0305

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000306	109	172	PF01363	Zinc finger
HMMSmart	IPR000306	106	172	SM00064	Zinc finger
ProfileScan	IPR002110	1	105	PS50297	Ankyrin
	IPR002110	50	82	PS50088	Ankyrin
	IPR000306	111	171	PS50178	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-