ROUGE |
Gene/Protein Characteristic Table for mKIAA1308 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129328 |
---|---|
Ral guanine nucleotide dissociation stimulator. | |
mbh02485 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3590 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 814 bp Genome contig ID gi66880554f_28345528 PolyA signal sequence
(ATTAAA,-31) +----*----+----*----+----*----+----
TTATATTAAAATCCCGTTTCTACTACGGCCTGGTCFlanking genome sequence
(139718 - 139767) ----+----*----+----*----+----*----+----*----+----*
ACTGTGGTTTTACTGTTTTTATTTCCTTGCTTATTTTCAGGGTTTTCTGA
KIAA Alignment based on: KIAA1308 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..2776
Length: 924 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |