Gene/Protein Characteristic Table for mFLJ00153

Length: 4632 bp

Restriction map

Length of 3'UTR	2940 bp
Genome contig ID	gi65519420r_21758619
PolyA signal sequence (AAGAAA,-22)	+----*----+----*----+----*----+---- AATAATTCAAAGTAAGAAAGCCAAACCAACCAAAC
Flanking genome sequence (99797 - 99748)	----+----*----+----*----+----*----+----*----+----* AACAACAAGGAACATTCTTGGGTGTCTTGATTTTTTGGTCTCTGTCATAA

KIAA	Alignment based on:
FLJ00153	DNA sequence, AA sequence, Physical map

Coding region: 2..250, 349..1614

Length: 505 aa

Entry Exp ID% Protein Source BAD21390 1.3e-142 100.0 mFLJ00153 prote... Mus musculus AAF78208 1.7e-142 100.0 RalGDS-like pro... Mus musculus Q3UYI5 1.7e-142 100.0 Ral guanine nuc... Mus musculus BAE22227 3.8e-142 99.8 unnamed protein... Mus musculus BAC35425 5.5e-142 99.6 unnamed protein... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129328 2.3e-19 42.5 mKIAA1308 AK173071 6.8e-05 38.2 mKIAA0959

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001895	66	273	PF00617	Guanine-nucleotide dissociation stimulator CDC25
	IPR000159	433	505	PF00788	RA
HMMSmart	IPR001895	65	325	SM00147	Guanine-nucleotide dissociation stimulator CDC25
ProfileScan	IPR001895	72	323	PS50009	Guanine-nucleotide dissociation stimulator CDC25
	IPR000694	356	419	PS50099	Proline-rich region
	IPR000159	433	505	PS50200	RA
ScanRegExp	IPR001895	240	270	PS00720	Guanine-nucleotide dissociation stimulator CDC25

Method	From	To	amino acid sequence
-	-	-	-