ROUGE |
Gene/Protein Characteristic Table for mKIAA1097 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122442 |
---|---|
ubiquitin specific protease 33. pVHL-interacting deubiquitinating enzyme 1. Vhlh-interacting deubiquitinating enzyme 1. |
|
mbg07126 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6368 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 967 bp Genome contig ID gi65492966f_151239537 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TTAAAACTCATTCAATAAAAATAATTCTAAAATGTFlanking genome sequence
(135488 - 135537) ----+----*----+----*----+----*----+----*----+----*
ATAAACTGAATGTTGAATTTATTTGATAGACTTTTTAAAAAAGGTGTAAA
KIAA Alignment based on: KIAA1097 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..497, 644..1585, 4322..5401
Length: 838 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |