ROUGE |
Gene/Protein Characteristic Table for mKIAA4155 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220512 |
---|---|
Ubiquitin carboxyl-terminal hydrolase 4. | |
mfj33105 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3457 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1208 bp Genome contig ID gi65519420f_108317803 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CAGGGCTACACAGAGAAACCCTGTCTCGAAACACCFlanking genome sequence
(138030 - 138079) ----+----*----+----*----+----*----+----*----+----*
AAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Features of the protein sequence |
Description | |
Coding region: 6..2246
Length: 747 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |