ROUGE

Gene/Protein Characteristic Table for mKIAA4085

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220478
Description :	Ubiquitin carboxyl-terminal hydrolase 11 (Fragment).
Clone Name :	mbh02992 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 3977 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2438 bp

Genome contig ID gi66880665f_18850969
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
GCCTCCTAAGTGCTGGCATTAAAAGCATGACCACC
Flanking genome sequence
(108511 - 108560)
----+----*----+----*----+----*----+----*----+----*
ACACCTAGCTGTTTTGAGTGTTTATTAGTCACCTGAGCAACAGGTGCTGT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 1..1536
Length: 512 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAM23095	0	100.0	ubiquitin speci...	Mus musculus
Q99K46	0	100.0	Ubiquitin carbo...	Mus musculus
AAH90333	0	98.0	Ubiquitin speci...	Rattus norvegicus
P51784	9.4e-200	85.0	Ubiquitin carbo...	Homo sapiens
AAH63668	9.5e-200	85.0	USP11 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220512	2.4e-85	49.0	mKIAA4155
AK122301	3.8e-85	49.7	mKIAA0529
AK122396	9.7e-51	42.8	mKIAA0891
AK122195	9.9e-36	44.1	mKIAA0055
AK173083	3.6e-12	38.3	mKIAA1003

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010460 17 159 PF06337 Ubiquitin carboxyl-terminal hydrolase

IPR001394 178 465 PF00443 Peptidase C19

ProfileScan IPR001394 181 512 PS50235 Peptidase C19

ScanRegExp IPR001394 182 197 PS00972 Peptidase C19

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010460	17	159	PF06337	Ubiquitin carboxyl-terminal hydrolase
IPR001394	178	465	PF00443	Peptidase C19
ProfileScan	IPR001394	181	512	PS50235	Peptidase C19
ScanRegExp	IPR001394	182	197	PS00972	Peptidase C19

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2438 bp
Genome contig ID	gi66880665f_18850969
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- GCCTCCTAAGTGCTGGCATTAAAAGCATGACCACC
Flanking genome sequence (108511 - 108560)	----+--------+--------+--------+--------+----* ACACCTAGCTGTTTTGAGTGTTTATTAGTCACCTGAGCAACAGGTGCTGT

Gene/Protein Characteristic Table for mKIAA4085

Features of the cloned DNA sequence

Features of the protein sequence