ROUGE

Gene/Protein Characteristic Table for mKIAA0976

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173075
Description :	Netrin G1 precursor.
Clone Name :	mfj12230 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4833 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2636 bp

Genome contig ID gi65492966r_109489112
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
ATCTGCTTTTAATAAAAATTCACTTTTAGGTATAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACAAACGTAAATGAAATGTTCTTTTAAATCTGGTTCTTTTAAAAGTCGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0976 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0976	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 785..2197
Length: 470 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB12008	3.4e-196	100.0	Netrin-G1c [Mus...	Mus musculus
AAL84780	6.2e-196	99.8	laminet-1C [Mus...	Mus musculus do...
EDL81983	1.9e-191	97.3	similar to netr...	Rattus norvegicus
AAH30220	1.2e-188	95.9	Netrin G1 [Homo...	Homo sapiens
AAQ88731	2.8e-187	95.2	YLSR571 [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220426	1.6e-09	52.6	mKIAA1857
AK129157	2.3e-05	26.6	mKIAA0533

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008211 82 327 PF00055 Laminin

IPR002049 329 373 PF00053 Laminin-type EGF-like

HMMSmart IPR008211 91 327 SM00136 Laminin

IPR002049 329 386 SM00180 Laminin-type EGF-like

ScanRegExp IPR006209 347 358 PS00022 EGF-like

IPR006209 417 428 PS00022 EGF-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008211	82	327	PF00055	Laminin
IPR002049	329	373	PF00053	Laminin-type EGF-like
HMMSmart	IPR008211	91	327	SM00136	Laminin
IPR002049	329	386	SM00180	Laminin-type EGF-like
ScanRegExp	IPR006209	347	358	PS00022	EGF-like
IPR006209	417	428	PS00022	EGF-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 32 54 EMYLSRFLSIHALWVTVSSVMQP

451 470 GSPALLLLTMLLGTAGPLVF

Method	From	To	amino acid sequence
SOSUI	32	54	EMYLSRFLSIHALWVTVSSVMQP
451	470	GSPALLLLTMLLGTAGPLVF

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2636 bp
Genome contig ID	gi65492966r_109489112
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ATCTGCTTTTAATAAAAATTCACTTTTAGGTATAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACAAACGTAAATGAAATGTTCTTTTAAATCTGGTTCTTTTAAAAGTCGA

Gene/Protein Characteristic Table for mKIAA0976

Features of the cloned DNA sequence

Features of the protein sequence