ROUGE

Gene/Protein Characteristic Table for mKIAA1857

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220426
Description :	Netrin G2 precursor.
Clone Name :	mbg20504 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5446 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3219 bp

Genome contig ID gi66880554r_29075535
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCAGGACAGTCAGGGCTACACAGAGACCCTGTCTC
Flanking genome sequence
(99866 - 99817)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAACCACACACAACACAACAACAACAACAGAGTGCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1857 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA1857	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 587..889
Length: 101 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAM16245	4.3e-31	100.0	netrin G2 [Mus ...	Mus musculus
BAB71994	5e-31	100.0	Netrin-G2a [Mus...	Mus musculus
BAB71996	5.3e-31	100.0	Netrin-G2c [Mus...	Mus musculus
BAB71995	5.5e-31	100.0	Netrin-G2b [Mus...	Mus musculus
EDL93387	1.7e-30	98.6	netrin G2 (pred...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173075	1.8e-13	52.6	mKIAA0976

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3219 bp
Genome contig ID	gi66880554r_29075535
PolyA signal sequence (None)	+--------+--------+----*----+---- CCAGGACAGTCAGGGCTACACAGAGACCCTGTCTC
Flanking genome sequence (99866 - 99817)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAACCACACACAACACAACAACAACAACAGAGTGCC

Gene/Protein Characteristic Table for mKIAA1857

Features of the cloned DNA sequence

Features of the protein sequence