ROUGE |
Gene/Protein Characteristic Table for mKIAA0973 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122411 |
---|---|
syntrophin associated serine/threonine kinase. syntrophin-associated serine-threonine protein kinase. |
|
mbg08419 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4509 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1953 bp Genome contig ID gi65515060r_84079085 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TAACCCACCAACAGACACACAAACAAATTCAAGTCFlanking genome sequence
(99790 - 99741) ----+----*----+----*----+----*----+----*----+----*
AAAACTAGTCTCTGAGTCTTTTCTTTCTTTCTTTCTTTTCTCTTTTTCTT
KIAA Alignment based on: KIAA0973 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 35..727, 865..2523, 2742..3998
Length: 1202 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |