ROUGE

Gene/Protein Characteristic Table for mKIAA0807

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093264
Description :	microtubule associated serine/threonine kinase 2. microtubule associated testis specific serine/threonine protein kinase.
Clone Name :	mbg07407 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4353 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 52 bp

Genome contig ID gi65493515r_115165669
PolyA signal sequence
(AATACA,-20)
+----*----+----*----+----*----+----
TACATTCACCTGTGTAATACACCCTCCTGGAAACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCTTGGCCTGTGTTTGCTTCTTTCCATTGGTCATTATCCACAGACTCTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0807 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0807	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..4301
Length: 1432 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH60703	99.9	Mast2 protein [...	Mus musculus
EDL30609	99.9	microtubule ass...	Mus musculus
NP_001036208	99.9	microtubule ass...	Mus musculus
CAM16398	99.8	microtubule ass...	Mus musculus
NP_032667	99.8	microtubule ass...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122411	4.2e-79	54.9	mKIAA0973
AK172971	4.5e-27	53.8	mKIAA0561
AK220517	1.4e-06	31.9	mKIAA4165
AK122331	5.8e-06	26.2	mKIAA0623
AK122357	0.00032	24.1	mKIAA0722

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 152 425 PD000001 Protein kinase

HMMPfam IPR000719 152 425 PF00069 Protein kinase

IPR000961 443 488 PF00433 Protein kinase

IPR001478 741 826 PF00595 PDZ/DHR/GLGF

HMMSmart IPR002290 152 425 SM00220 Serine/threonine protein kinase

IPR001245 152 425 SM00219 Tyrosine protein kinase

IPR001478 749 829 SM00228 PDZ/DHR/GLGF

ProfileScan IPR000719 152 425 PS50011 Protein kinase

IPR001478 741 829 PS50106 PDZ/DHR/GLGF

NULL 882 954 PS50324 NULL

ScanRegExp IPR008271 271 283 PS00108 Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	152	425	PD000001	Protein kinase
HMMPfam	IPR000719	152	425	PF00069	Protein kinase
IPR000961	443	488	PF00433	Protein kinase
IPR001478	741	826	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR002290	152	425	SM00220	Serine/threonine protein kinase
IPR001245	152	425	SM00219	Tyrosine protein kinase
IPR001478	749	829	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000719	152	425	PS50011	Protein kinase
IPR001478	741	829	PS50106	PDZ/DHR/GLGF
NULL	882	954	PS50324	NULL
ScanRegExp	IPR008271	271	283	PS00108	Serine/threonine protein kinase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	52 bp
Genome contig ID	gi65493515r_115165669
PolyA signal sequence (AATACA,-20)	+--------+--------+----*----+---- TACATTCACCTGTGTAATACACCCTCCTGGAAACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTTGGCCTGTGTTTGCTTCTTTCCATTGGTCATTATCCACAGACTCTA

Gene/Protein Characteristic Table for mKIAA0807

Features of the cloned DNA sequence

Features of the protein sequence