ROUGE |
Gene/Protein Characteristic Table for mKIAA0787 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122370 |
---|---|
calcium/calmodulin-dependent protein kinase kinase 2, beta. | |
mbg06488 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4763 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3502 bp Genome contig ID gi65498774r_121786114 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ATTGTCAGCTAAGCTAATTCTCTTTGTAAATTGGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAACAACCAAAAACAAAAAAAAAAAAAACCCAA
KIAA Alignment based on: KIAA0787 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1261
Length: 419 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |