ROUGE

Gene/Protein Characteristic Table for mKIAA4163

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220516
Description :	calcium/calmodulin-dependent protein kinase II, delta. CaMK II.
Clone Name :	mfj30170 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4180 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2152 bp

Genome contig ID gi65492966f_125380203
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
ATTTAAGAGTTAATAAATTTGGGATTTCTGCTGAC
Flanking genome sequence
(347964 - 348013)
----+----*----+----*----+----*----+----*----+----*
AATGTGTCCATTTTTATTTCTTAAGAAATACTCTATGTGTGGTGCCGGCC

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 418..2025
Length: 536 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
ABK42143	1.8e-209	100.0	calmodulin-depe...	synthetic construct
EAX06299	5.2e-209	100.0	calcium/calmodu...	Homo sapiens
P15791	8.2e-208	99.2	Calcium/calmodu...	Rattus norvegicus
NP_001020610	1.9e-207	99.0	calcium/calmodu...	Mus musculus
BAC30232	4e-207	98.8	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122410	2.5e-114	80.8	mKIAA0968
AB093234	3.2e-39	34.5	mKIAA0369
AK220191	3.6e-29	31.1	mKIAA4207
AK220557	4.8e-29	36.8	mKIAA4230
AK173268	5.1e-29	37.9	mKIAA4256

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 38 295 PD000001 Protein kinase

HMMPfam IPR000719 38 296 PF00069 Protein kinase

HMMSmart IPR002290 38 296 SM00220 Serine/threonine protein kinase

IPR001245 38 296 SM00219 Tyrosine protein kinase

ProfileScan IPR000719 38 296 PS50011 Protein kinase

ScanRegExp IPR000719 44 67 PS00107 Protein kinase

IPR008271 156 168 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	38	295	PD000001	Protein kinase
HMMPfam	IPR000719	38	296	PF00069	Protein kinase
HMMSmart	IPR002290	38	296	SM00220	Serine/threonine protein kinase
IPR001245	38	296	SM00219	Tyrosine protein kinase
ProfileScan	IPR000719	38	296	PS50011	Protein kinase
ScanRegExp	IPR000719	44	67	PS00107	Protein kinase
IPR008271	156	168	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 217 239 KPVDMWACGVILYILLVGYPPFW

Method	From	To	amino acid sequence
SOSUI	217	239	KPVDMWACGVILYILLVGYPPFW

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2152 bp
Genome contig ID	gi65492966f_125380203
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ATTTAAGAGTTAATAAATTTGGGATTTCTGCTGAC
Flanking genome sequence (347964 - 348013)	----+--------+--------+--------+--------+----* AATGTGTCCATTTTTATTTCTTAAGAAATACTCTATGTGTGGTGCCGGCC

Gene/Protein Characteristic Table for mKIAA4163

Features of the cloned DNA sequence

Features of the protein sequence