ROUGE |
Gene/Protein Characteristic Table for mKIAA4256 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173268 |
---|---|
mfj04284 [Vector Info] | |
Source : | Mouse fetal brain |
Note : | The gene name of mfj04284 was changed from mKIAA1811 to mKIAA4256, because this gene is not a mouse ortholog of KIAA1811 |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4133 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2015 bp Genome contig ID gi65511124f_136294367 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TCAGTTCTGGAACAATAAATTCCTTCCATAAAGACFlanking genome sequence
(122678 - 122727) ----+----*----+----*----+----*----+----*----+----*
ACATGACGCAAGGTTTCCGTCCGGGTCGGGTGGGCTTGGGAAATGGCACA
Features of the protein sequence |
Description | |
Coding region: 1..2115
Length: 705 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |