KIAA0787

Product ID	ORK04429
Accession No	AB018330
Description	calcium/calmodulin-dependent protein kinase kinase 2, beta
Clone name	hk05521s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-173) was subcloned upstream of the cDNA (174-4450). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGT-5' end of cDNA.
cDNA sequence	DNA sequence (4450 bp) Predicted protein sequence (557 aa)
Source	Human adult brain
Rouge ID	mKIAA0787 by Kazusa Mouse cDNA Project
Note	We replaced hk05521, former representative clones for KIAA0787 with hk05521s1. (2002/5/10)

Length: 4450 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2774 bp
Genome contig ID	gi89161190r_120059880
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTACAGTTGAAATAAACAGACAGCAAAATGGTGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCCTGGGCCTCTTGGGGAGGTTTGTATTGGTGATTGTTTATTTAGGCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	120159880	120196717	16	99.2	Perfect prediction

Length: 557 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW98247	0	99.6	calcium/calmodu...	Homo sapiens
XP_001093677	1.2e-216	98.6	similar to calc...	Macaca mulatta
Q96RR4	1.1e-210	98.9	Calcium/calmodu...	Homo sapiens
EAW98254	1.7e-210	98.7	calcium/calmodu...	Homo sapiens
AAK91829	1.7e-210	98.7	Ca2+/calmodulin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D43636	5.9e-20	32.5	KIAA0096
AB018324	6e-20	30.8	KIAA0781
AB058763	3.5e-19	31.0	KIAA1860
AB058714	1.1e-18	34.2	KIAA1811
AB023185	1.2e-18	31.8	KIAA0968

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	166	446	PD000001	Protein kinase
HMMPfam	IPR000719	166	447	PF00069	Protein kinase
HMMSmart	IPR001245	166	441	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	166	447	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	166	447	PS50011	Protein kinase
ScanRegExp	IPR000719	172	195	PS00107	Protein kinase
ScanRegExp	IPR008271	309	321	PS00108	Serine/threonine protein kinase

Primer_f	AGAACCATGACCTCCACTTGC
Primer_r	AAACAGAAGCATCGGGCATTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGAACCATGACCTCCACTTGC
Primer_r	AAACAGAAGCATCGGGCATTG
PCR product length	141 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles