Gene/Protein Characteristic Table for mKIAA0780

Length: 4254 bp

Restriction map

Length of 3'UTR	864 bp
Genome contig ID	gi65493515f_73213099
PolyA signal sequence (ATTAAA,-21)	+----*----+----*----+----*----+---- ATTAATATTTAAAAATTAAAATCTGTTTTCTCCTG
Flanking genome sequence (253984 - 254033)	----+----*----+----*----+----*----+----*----+----* TCCCGTCTTCTGTCTGTCAATTTTCTCTAAATTAAAACACCCCTTATTTG

KIAA	Alignment based on:
KIAA0780	DNA sequence, AA sequence, Physical map

Coding region: 1..3390

Length: 1129 aa

Entry Exp ID% Protein Source Q8VCD7 0 100.0 JmjC domain-con... Mus musculus BAE25700 0 99.9 unnamed protein... Mus musculus EDL31052 0 100.0 jumonji domain ... Mus musculus Q9H3R0 0 84.6 JmjC domain-con... Homo sapiens AAI04860 0 84.5 Jumonji domain ... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129233 6.2e-96 51.8 mKIAA0876 AK129187 3.4e-92 53.8 mKIAA0677 AK129096 3.5e-16 24.8 mKIAA0234 AK220451 1.1e-15 23.3 mKIAA4034 AK129091 6.8e-13 31.9 mKIAA0215

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003349	90	137	PF02375	Transcription factor jumonji
	IPR003347	252	368	PF02373	Transcription factor jumonji
HMMSmart	IPR003349	90	132	SM00545	Transcription factor jumonji
	IPR001965	762	820	SM00249	Zinc finger
	IPR001965	882	938	SM00249	Zinc finger
	IPR002999	950	1007	SM00333	Tudor
	IPR002999	1008	1064	SM00333	Tudor

Method	From	To	amino acid sequence
-	-	-	-