ROUGE

Gene/Protein Characteristic Table for mKIAA4034

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220451
Description :	PLU1. putative DNA/chromatin binding motif 1.
Clone Name :	mbg21043 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5413 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 712 bp

Genome contig ID gi65488608f_134310456
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TATTCCTTATGGGATCATTTTTCCAGAACTCTTTG
Flanking genome sequence
(171332 - 171381)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGAAAAAACAACTAAAAAAATTTTGACACTTTTTTGTAATTTTT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 37..4698
Length: 1554 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL39602	99.5	jumonji, AT ric...	Mus musculus
Q80Y84	99.5	Histone demethy...	Mus musculus
EDL39603	99.4	jumonji, AT ric...	Mus musculus
AAL92848	99.4	PLU1 [Mus muscu...	Mus musculus
EDM09721	96.6	similar to PLU1...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129096	2.4e-143	45.4	mKIAA0234
AK129187	1.1e-14	35.3	mKIAA0677
AK173023	4.7e-14	23.5	mKIAA0780
AK129233	5.4e-14	35.0	mKIAA0876
AK122243	0.0001	40.3	mKIAA0314

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003349 68 114 PF02375 Transcription factor jumonji

IPR001606 131 239 PF01388 AT-rich interaction region

IPR001965 348 396 PF00628 Zinc finger

IPR003347 523 639 PF02373 Transcription factor jumonji

IPR004198 729 782 PF02928 Zinc finger

IPR001965 1215 1261 PF00628 Zinc finger

HMMSmart IPR003349 68 109 SM00545 Transcription factor jumonji

IPR001606 135 225 SM00501 AT-rich interaction region

IPR001965 348 394 SM00249 Zinc finger

IPR001965 1215 1259 SM00249 Zinc finger

ProfileScan IPR001965 346 396 PS50016 Zinc finger

IPR001965 1213 1261 PS50016 Zinc finger

ScanRegExp IPR001965 349 393 PS01359 Zinc finger

IPR001965 1216 1258 PS01359 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003349	68	114	PF02375	Transcription factor jumonji
IPR001606	131	239	PF01388	AT-rich interaction region
IPR001965	348	396	PF00628	Zinc finger
IPR003347	523	639	PF02373	Transcription factor jumonji
IPR004198	729	782	PF02928	Zinc finger
IPR001965	1215	1261	PF00628	Zinc finger
HMMSmart	IPR003349	68	109	SM00545	Transcription factor jumonji
IPR001606	135	225	SM00501	AT-rich interaction region
IPR001965	348	394	SM00249	Zinc finger
IPR001965	1215	1259	SM00249	Zinc finger
ProfileScan	IPR001965	346	396	PS50016	Zinc finger
IPR001965	1213	1261	PS50016	Zinc finger
ScanRegExp	IPR001965	349	393	PS01359	Zinc finger
IPR001965	1216	1258	PS01359	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	712 bp
Genome contig ID	gi65488608f_134310456
PolyA signal sequence (None)	+--------+--------+----*----+---- TATTCCTTATGGGATCATTTTTCCAGAACTCTTTG
Flanking genome sequence (171332 - 171381)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAAACAACTAAAAAAATTTTGACACTTTTTTGTAATTTTT

Gene/Protein Characteristic Table for mKIAA4034

Features of the cloned DNA sequence

Features of the protein sequence