ROUGE

Gene/Protein Characteristic Table for mKIAA0516

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172961
Description :	sperm associated antigen 9. JNK-associated leucine-zipper.
Clone Name :	mbg07952 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6892 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3243 bp

Genome contig ID gi65527427f_93765311
PolyA signal sequence
(TATAAA,-16)
+----*----+----*----+----*----+----
ACTTTGTACATGAAATATATATAAATATGTATATG
Flanking genome sequence
(181859 - 181908)
----+----*----+----*----+----*----+----*----+----*
AAACATGTGTGAAGTCTAGTGTGGTTTGTTTTTATCTTTCTTGGGGCTCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0516 DNA sequence

KIAA	Alignment based on:
KIAA0516	DNA sequence

Features of the protein sequence	Description

Coding region: 62..3649
Length: 1195 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001020600	100.0	sperm associate...	Mus musculus
NP_001020599	99.6	sperm associate...	Mus musculus
AAH60100	99.7	Sperm associate...	Mus musculus
XP_511886	95.7	sperm associate...	Pan troglodytes
XP_866070	95.5	similar to sper...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AB093282	7.4e-69	54.9	mKIAA1066
AK122250	5.3e-13	22.8	mKIAA0337
AK129408	6.8e-10	28.9	mKIAA1626
AK220332	1.9e-08	24.1	mKIAA0294

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

None - - - - -

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 39 61 GFVGGAVVINSAILVSLSVLLLV

Method	From	To	amino acid sequence
SOSUI	39	61	GFVGGAVVINSAILVSLSVLLLV

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3243 bp
Genome contig ID	gi65527427f_93765311
PolyA signal sequence (TATAAA,-16)	+--------+--------+----*----+---- ACTTTGTACATGAAATATATATAAATATGTATATG
Flanking genome sequence (181859 - 181908)	----+--------+--------+--------+--------+----* AAACATGTGTGAAGTCTAGTGTGGTTTGTTTTTATCTTTCTTGGGGCTCT

Gene/Protein Characteristic Table for mKIAA0516

Features of the cloned DNA sequence

Features of the protein sequence