ROUGE

Gene/Protein Characteristic Table for mKIAA1066

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093282
Description :	C-jun-amino-terminal kinase interacting protein 3.
Clone Name :	mbg07245 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5411 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1415 bp

Genome contig ID gi65550231r_22603451
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
ATATCTGCTCTGTATGTAATAAATGTCTTAACACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTTTGTCTTGAAACTTCACCAGCGCACAAGGGTTTTCTGCAGTTTTAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1066 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1066	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 10..3996
Length: 1328 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL22389	99.7	mitogen-activat...	Mus musculus
EDL22388	99.6	mitogen-activat...	Mus musculus
BAA85874	99.9	JNK/SAPK-associ...	Mus musculus
BAB16674	99.4	JNK/SAPK-associ...	Mus musculus
AAH65105	99.5	Mapk8ip3 protei...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172961	8.7e-58	54.9	mKIAA0516
AK122250	3.8e-11	22.3	mKIAA0337
AK129408	1.4e-08	26.6	mKIAA1626
AK220332	1e-06	29.0	mKIAA0294

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1415 bp
Genome contig ID	gi65550231r_22603451
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATATCTGCTCTGTATGTAATAAATGTCTTAACACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTTTGTCTTGAAACTTCACCAGCGCACAAGGGTTTTCTGCAGTTTTAT

Gene/Protein Characteristic Table for mKIAA1066

Features of the cloned DNA sequence

Features of the protein sequence