ROUGE

Gene/Protein Characteristic Table for mKIAA0337

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122250
Description :
Clone Name :	mbg04504 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4516 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1265 bp

Genome contig ID gi65511124r_94878812
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
TGATGAAATTTAAAGAGTCAATAAATAGAAACACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATGATGGCTCCCCCGGGCCTTGGGCCATCATGGCCTCCTGCCAGCTGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0337 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0337	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..3251
Length: 1082 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL16483	100.0	mCG116432, isof...	Mus musculus
EDL16482	97.6	mCG116432, isof...	Mus musculus
Q80U35	97.4	Rho guanine nuc...	Mus musculus
XP_001917491	95.1	Rho guanine nuc...	Equus caballus
XP_851853	93.0	similar to Rho ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129408	1.4e-15	25.0	mKIAA1626
AK220332	8.4e-15	22.9	mKIAA0294
AB093282	1.8e-12	22.1	mKIAA1066
AK172961	8e-12	22.6	mKIAA0516
AK220452	3.6e-10	26.1	mKIAA4037

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000219 88 271 PF00621 DH

HMMSmart IPR000219 88 271 SM00325 DH

ProfileScan IPR000219 84 272 PS50010 DH

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	88	271	PF00621	DH
HMMSmart	IPR000219	88	271	SM00325	DH
ProfileScan	IPR000219	84	272	PS50010	DH

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 942 964 RITALLVCAELLWVGTSAGVVLT

Method	From	To	amino acid sequence
SOSUI	942	964	RITALLVCAELLWVGTSAGVVLT

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1265 bp
Genome contig ID	gi65511124r_94878812
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TGATGAAATTTAAAGAGTCAATAAATAGAAACACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGATGGCTCCCCCGGGCCTTGGGCCATCATGGCCTCCTGCCAGCTGT

Gene/Protein Characteristic Table for mKIAA0337

Features of the cloned DNA sequence

Features of the protein sequence