| ROUGE | 
Gene/Protein Characteristic Table for mKIAA0294 | 
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220332 | 
|---|---|
| Rho guanine nucleotide exchange factor 10. | |
| mbg02039 [Vector Info] | |
| Source : | Mouse brain | 
Features of the cloned DNA sequence | 
Description | |
|---|---|---|
Length: 4697 bp
 
       | 
| cloned DNA seq. | |
Warning for N-terminal truncation:  | NO | 
Warning for coding interruption:  | YES | 
Length of 3'UTR 616 bp Genome contig ID gi65515060f_14203532 PolyA signal sequence 
(ATTAAA,-25) +----*----+----*----+----*----+----
ATTTTTTTCTATTAAAAATCAACAGTTAACATTTTFlanking genome sequence 
(175399 - 175448) ----+----*----+----*----+----*----+----*----+----*
AGTCAATGTACTCTCTGTAGCATTTCACACATAATCTTTACTTGAAGCCA
KIAA Alignment based on: KIAA0294 DNA sequence, AA sequence, Physical map 
Features of the protein sequence | 
Description | |
Coding region: 107..4078
Length: 1324 aa
![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
    | 
 
 How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage  
 
  | |