ROUGE |
Gene/Protein Characteristic Table for mKIAA0407 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129133 |
---|---|
plexin B1. | |
mpm02292 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4320 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 694 bp Genome contig ID gi65519420f_109052215 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
GATGCTATAGCTCTTCATTAAAGGATAACACATGGFlanking genome sequence
(113017 - 113066) ----+----*----+----*----+----*----+----*----+----*
TATGGACTCACCAGCCCCTCTGCTAAGATAGAACTGGCAGCTGCTGGGAG
KIAA Alignment based on: KIAA0407 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..3626
Length: 1207 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |