| ROUGE |
Gene/Protein Characteristic Table for mKIAA1206 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK122467 |
|---|---|
| plexin B3. plexin 6. |
|
| mbg00219 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5249 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3321 bp Genome contig ID gi66880665f_68320549 PolyA signal sequence
(AATAAA,-30) +----*----+----*----+----*----+----
CTGGAAATAAAGTAGAAACACATCTTTTTAAAAACFlanking genome sequence
(112617 - 112666) ----+----*----+----*----+----*----+----*----+----*
AATCTCAATCTGAAGCCCCTGACTTTTCCTGCCAAGTGTGAGCTCTCAGT
KIAA Alignment based on: KIAA1206 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1895, 1928..2683, 3511..4080, 4085..4990
Length: 1374 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |