Gene/Protein Characteristic Table for mKIAA0359

Length: 5583 bp

Restriction map

Length of 3'UTR	3225 bp
Genome contig ID	gi66880554f_152648392
PolyA signal sequence (AATAAA,-25)	+----*----+----*----+----*----+---- TAAAATGTGTAATAAAAATCAATCAAATTTATTGT
Flanking genome sequence (141928 - 141977)	----+----*----+----*----+----*----+----*----+----* ATCTACAAAGAGGTGTCCTTGTCAGTGATTGGTGCCTTTTCGAATGATTT

KIAA	Alignment based on:
KIAA0359	DNA sequence, AA sequence, Physical map

Coding region: 85..2358

Length: 757 aa

Entry Exp ID% Protein Source Q61771 0 100.0 Kinesin-like pr... Mus musculus EDL06022 0 99.9 kinesin family ... Mus musculus BAC38996 0 99.9 unnamed protein... Mus musculus BAE28411 0 99.7 unnamed protein... Mus musculus EDL86006 0 99.2 kinesin family ... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220283 8.9e-35 61.8 mKIAA4058 AK220479 3e-23 35.7 mKIAA4086 AK173007 2.3e-22 40.2 mKIAA0706 AB093244 5.8e-22 35.6 mKIAA0531 AF090190 3.2e-21 32.1 mKIAA0591

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	97	118	PR00380	Kinesin
	IPR001752	216	233	PR00380	Kinesin
	IPR001752	250	268	PR00380	Kinesin
	IPR001752	300	321	PR00380	Kinesin
HMMPfam	IPR001752	25	351	PF00225	Kinesin
HMMSmart	IPR001752	17	358	SM00129	Kinesin
ProfileScan	IPR001752	16	280	PS50067	Kinesin
	NULL	404	605	PS50313	NULL
ScanRegExp	IPR001752	249	260	PS00411	Kinesin

Method	From	To	amino acid sequence
-	-	-	-