ROUGE |
Gene/Protein Characteristic Table for mKIAA0224 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172917 |
---|---|
DEAH (Asp-Glu-Ala-His) box polypeptide 38. pre-mRNA splicing factor 16. DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38. |
|
mpg04132 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4197 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1433 bp Genome contig ID gi65515060r_108745689 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
ATGGGGTTTGGAAATAAATATATTATTTGTACAATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTATTGCATTTTAAATCTCCTTTCTCTTTTATAGCTCTTATCCCTGCAA
KIAA Alignment based on: KIAA0224 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 128..2755, 2764..3810
Length: 1224 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |