Gene/Protein Characteristic Table for mKIAA0213

Length: 4986 bp

Restriction map

Length of 3'UTR	477 bp
Genome contig ID	gi65550231r_10767074
PolyA signal sequence (AATAAA,-26)	+----*----+----*----+----*----+---- TTCTTTTTCAATAAATGGTTTATTTTAGGAAAGCG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AAGTCAGCGTCTGTTACTGGCTCACGGCTTAAGAGCAGGACGGCCTGCAG

KIAA	Alignment based on:
KIAA0213	DNA sequence, AA sequence, Physical map

Coding region: 1..4509

Length: 1502 aa

Entry Exp ID% Protein Source AAH58719 0 100.0 Mitogen-activat... Mus musculus O08648 0 99.9 Mitogen-activat... Mus musculus XP_001491283 0 89.6 similar to mito... Equus caballus NP_005913 0 89.5 mitogen-activat... Homo sapiens EAW47587 0 89.5 mitogen-activat... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122218 6.1e-19 31.0 mKIAA0204 AK220448 1.2e-16 33.2 mKIAA4026 AK173292 2.6e-15 32.0 mKIAA1901 AK129298 1.1e-14 27.6 mKIAA1142 AK220528 4.2e-14 36.1 mKIAA4182

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	1243	1483	PD000001	Protein kinase
HMMPfam	NULL	1237	1495	PF07714	NULL
	IPR000719	1237	1495	PF00069	Protein kinase
HMMSmart	IPR002290	1237	1495	SM00220	Serine/threonine protein kinase
	IPR001245	1237	1493	SM00219	Tyrosine protein kinase
ProfileScan	IPR000719	1237	1495	PS50011	Protein kinase
ScanRegExp	IPR000719	1243	1266	PS00107	Protein kinase
	IPR008271	1353	1365	PS00108	Serine/threonine protein kinase

Method	From	To	amino acid sequence
-	-	-	-