Order Kazusa clone(s) from : ![]() |
Product ID | ORK06896 |
---|---|
Accession No | D86959 |
Description | STE20-like kinase, transcript variant 2 |
Clone name | ha02801 |
Vector information | |
cDNA sequence | DNA sequence (5988 bp) Predicted protein sequence (1164 aa) |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0204
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2018 bp |
---|---|
Genome contig ID | gi89161187f_105616983 |
PolyA signal sequence (GATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (160351 - 160400) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 105716983 | 105777332 | 18 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 47 | 292 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 46 | 304 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 46 | 304 | SM00219 | Tyrosine protein kinase |
IPR002290 | 46 | 304 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 46 | 304 | PS50011 | Protein kinase |
IPR001943 | 887 | 922 | PS50151 | UvrB/UvrC protein | |
ScanRegExp | IPR000719 | 52 | 75 | PS00107 | Protein kinase |
IPR008271 | 163 | 175 | PS00108 | Serine/threonine protein kinase |
Panel name | Genebridge 4 |
---|---|
Primer_f | GAAAACTTTGGATGCTGAACC |
Primer_r | CTACCTACGAAGTTGTCCAAG |
PCR product length | 120 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |