| ROUGE |
Gene/Protein Characteristic Table for mKIAA1142 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129298 |
|---|---|
| Serine/threonine-protein kinase PAK 4. | |
| mph00410 [Vector Info] | |
| Source : | Mouse embryonic tail |
| Note : | We replaced mph01290, former representative clones for mKIAA1142 with mph00410. (2005/2/23) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2897 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 834 bp Genome contig ID gi65511124r_23864693 PolyA signal sequence
(ATTAAA,-29)
TTTACAATTAAAGTATTTTCTTGTTTTTGGTGAATFlanking genome sequence
(99999 - 99950)
GTGTGTGTATGTGTGTGGTCTATGGAGGCTACTGTCCAGCTATGTAGTAA
KIAA Alignment based on: KIAA1142 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 270..2063
Length: 597 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR000719 | 329 | 577 | PD000001 | Protein kinase |
| HMMPfam | IPR000095 | 14 | 71 | PF00786 | PAK-box/P21-Rho-binding |
| NULL | 327 | 578 | PF07714 | NULL | |
| IPR000719 | 327 | 578 | PF00069 | Protein kinase | |
| HMMSmart | IPR000095 | 15 | 50 | SM00285 | PAK-box/P21-Rho-binding |
| IPR002290 | 327 | 578 | SM00220 | Serine/threonine protein kinase | |
| IPR001245 | 327 | 578 | SM00219 | Tyrosine protein kinase | |
| ProfileScan | IPR000095 | 15 | 28 | PS50108 | PAK-box/P21-Rho-binding |
| IPR000694 | 220 | 302 | PS50099 | Proline-rich region | |
| IPR000719 | 327 | 578 | PS50011 | Protein kinase | |
| ScanRegExp | IPR000719 | 333 | 357 | PS00107 | Protein kinase |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage 
| |
