Gene/Protein Characteristic Table for mKIAA0048

Length: 3004 bp

Restriction map

Length of 3'UTR	1130 bp
Genome contig ID	gi65527427r_96674428
PolyA signal sequence (AATAAA,-22)	+----*----+----*----+----*----+---- AAAGTTTCTTGCTAATAAATTTAGTTGCCCAAGGC
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AAAGTCTGCGTTTGGCAGTTGGGCTTCCTTTGTCTGTGATGTCAGAGGTC

KIAA	Alignment based on:
KIAA0048	DNA sequence, AA sequence, Physical map

Coding region: 3..323, 327..1874

Length: 622 aa

Entry Exp ID% Protein Source Q9D2H6 3.5e-184 99.8 Transcription f... Mus musculus EDL16059 6.8e-184 99.7 Sp2 transcripti... Mus musculus BAC37190 1.2e-183 99.7 unnamed protein... Mus musculus BAE23947 2e-183 99.5 unnamed protein... Mus musculus EDL16060 2.6e-183 99.7 Sp2 transcripti... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK173164 3.7e-05 48.5 mKIAA1396 AK220556 4.3e-05 40.3 mKIAA4229 AK220539 4.5e-05 45.1 mKIAA4196 AK173240 5.3e-05 42.3 mKIAA1710 AK173284 6.7e-05 47.3 mKIAA1874

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	564	589	PD000003	Zinc finger
	IPR007087	594	616	PD000003	Zinc finger
FPrintScan	IPR007086	593	606	PR00048	Zinc finger
	IPR007086	609	618	PR00048	Zinc finger
HMMPfam	IPR007087	534	558	PF00096	Zinc finger
	IPR007087	564	588	PF00096	Zinc finger
	IPR007087	594	616	PF00096	Zinc finger
HMMSmart	IPR007087	534	558	SM00355	Zinc finger
	IPR007087	564	588	SM00355	Zinc finger
	IPR007087	594	616	SM00355	Zinc finger
ProfileScan	IPR000694	58	90	PS50099	Proline-rich region
	IPR007087	534	563	PS50157	Zinc finger
	IPR007087	564	593	PS50157	Zinc finger
	IPR007087	594	621	PS50157	Zinc finger
ScanRegExp	IPR007087	536	558	PS00028	Zinc finger
	IPR007087	566	588	PS00028	Zinc finger
	IPR007087	596	616	PS00028	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-