Gene/Protein Characteristic Table for mKIAA1874

Length: 6663 bp

Restriction map

Length of 3'UTR	1297 bp
Genome contig ID	gi65527427r_62404040
PolyA signal sequence (AATAAA,-20)	+----*----+----*----+----*----+---- ATTAGTTTATACGGGAATAAAATTATAGGAAAAGT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AATCGCAGGTTTTTAGTTTTTTGCCTTCCTATACCATTCTATTTTATGTT

KIAA	Alignment based on:
KIAA1874	DNA sequence, AA sequence, Physical map

Coding region: 4059..5366

Length: 435 aa

Entry Exp ID% Protein Source EDL10367 1.4e-178 100.0 zinc finger pro... Mus musculus BAC27444 1.4e-178 100.0 unnamed protein... Mus musculus AAH27023 5.4e-167 100.0 Zfp286 protein ... Mus musculus EDL10369 5.5e-167 100.0 zinc finger pro... Mus musculus XP_573110 2.8e-155 86.8 similar to zinc... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK173240 6.9e-56 48.0 mKIAA1710 AK173216 6.1e-54 48.4 mKIAA1611 AK173278 4.1e-53 51.0 mKIAA1852 AK173164 7.8e-53 47.6 mKIAA1396 AK172985 3.1e-51 53.9 mKIAA0628

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	157	180	PD000003	Zinc finger
	IPR007087	185	208	PD000003	Zinc finger
	IPR007087	240	263	PD000003	Zinc finger
	IPR007087	268	291	PD000003	Zinc finger
	IPR007087	296	319	PD000003	Zinc finger
	IPR007087	324	347	PD000003	Zinc finger
	IPR007087	352	374	PD000003	Zinc finger
	IPR007087	380	403	PD000003	Zinc finger
	IPR007087	408	431	PD000003	Zinc finger
FPrintScan	IPR007086	351	364	PR00048	Zinc finger
	IPR007086	395	404	PR00048	Zinc finger
HMMPfam	IPR007087	157	179	PF00096	Zinc finger
	IPR007087	185	207	PF00096	Zinc finger
	IPR007087	212	234	PF00096	Zinc finger
	IPR007087	240	262	PF00096	Zinc finger
	IPR007087	268	290	PF00096	Zinc finger
	IPR007087	296	318	PF00096	Zinc finger
	IPR007087	324	346	PF00096	Zinc finger
	IPR007087	352	374	PF00096	Zinc finger
	IPR007087	380	402	PF00096	Zinc finger
	IPR007087	408	430	PF00096	Zinc finger
HMMSmart	IPR007087	157	179	SM00355	Zinc finger
	IPR007087	185	207	SM00355	Zinc finger
	IPR007087	212	234	SM00355	Zinc finger
	IPR007087	240	262	SM00355	Zinc finger
	IPR007087	268	290	SM00355	Zinc finger
	IPR007087	296	318	SM00355	Zinc finger
	IPR007087	324	346	SM00355	Zinc finger
	IPR007087	352	374	SM00355	Zinc finger
	IPR007087	380	402	SM00355	Zinc finger
	IPR007087	408	430	SM00355	Zinc finger
ProfileScan	IPR007087	157	184	PS50157	Zinc finger
	IPR007087	185	208	PS50157	Zinc finger
	IPR007087	212	239	PS50157	Zinc finger
	IPR007087	240	267	PS50157	Zinc finger
	IPR007087	268	295	PS50157	Zinc finger
	IPR007087	296	323	PS50157	Zinc finger
	IPR007087	324	351	PS50157	Zinc finger
	IPR007087	352	379	PS50157	Zinc finger
	IPR007087	380	407	PS50157	Zinc finger
	IPR007087	408	435	PS50157	Zinc finger
ScanRegExp	IPR007087	159	179	PS00028	Zinc finger
	IPR007087	187	207	PS00028	Zinc finger
	IPR007087	214	234	PS00028	Zinc finger
	IPR007087	242	262	PS00028	Zinc finger
	IPR007087	270	290	PS00028	Zinc finger
	IPR007087	298	318	PS00028	Zinc finger
	IPR007087	326	346	PS00028	Zinc finger
	IPR007087	354	374	PS00028	Zinc finger
	IPR007087	382	402	PS00028	Zinc finger
	IPR007087	410	430	PS00028	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-