ROUGE |
Gene/Protein Characteristic Table for mFLJ00392 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220248 |
---|---|
Protein phosphatase 1 regulatory inhibitor subunit 16A. | |
mid31005 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2424 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 890 bp Genome contig ID gi65543215f_76622752 PolyA signal sequence
(GATAAA,-21) +----*----+----*----+----*----+----
TTATTGTGACTCTTGATAAAGGCTGTTTGCCACGGFlanking genome sequence
(123061 - 123110) ----+----*----+----*----+----*----+----*----+----*
AGCCTTCCCATGTGTCTCACTGGTTAGGAGCCACCCATGCCCAGGAGCAC
KIAA Alignment based on: FLJ00392 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 695..1387, 1534..2178
Length: 445 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |