| ROUGE |
Gene/Protein Characteristic Table for mFLJ00246 |
| Link to : NEDO | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK131166 |
|---|---|
| Weakly similar to gene TRAP ankyrin repeat containing protein (Fragment). | |
| mpm02140 [Vector Info] | |
| Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4373 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 583 bp Genome contig ID gi65551972f_36684549 PolyA signal sequence
(None)
AGAAAGCAAGCTCTTGCTGCTAAAAGAGAGAAGCGFlanking genome sequence
(182231 - 182280)
AAAAGAAAAGAGGAAAAAGAAAAAAGAGGAACAGAAAAGGAAACAGGAAG
KIAA Alignment based on: FLJ00246 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..3787, 3790..4365
Length: 1454 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
