ROUGE |
Gene/Protein Characteristic Table for mFLJ00318 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | X66223 |
---|---|
Retinoic acid receptor RXR-alpha. | |
mpj01782 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1921 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 504 bp Genome contig ID gi66880554f_27509583 PolyA signal sequence
(TATAAA,-16) +----*----+----*----+----*----+----
TCCTGGGTCATAGCTAACCTATAAAGCCTCTTTCCFlanking genome sequence
(182774 - 182823) ----+----*----+----*----+----*----+----*----+----*
AAAGATGCCCTGAGATATCACTCCAAGCAGGATTCTGGGACCACCTTGAG
KIAA Alignment based on: FLJ00318 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 2..1417
Length: 471 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |