ROUGE

Gene/Protein Characteristic Table for mKIAA4145

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220507
Description :	Orphan nuclear receptor TR4.
Clone Name :	mbg01377 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6518 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5425 bp

Genome contig ID gi65504368f_92504803
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
CATGAGGTTTATACTATTAAAGTAAATTCAAGACT
Flanking genome sequence
(115695 - 115744)
----+----*----+----*----+----*----+----*----+----*
AGTATGTGTGCTGCTCATCTTTTTTTCCTCAAAACAGTCACATGTGGCCT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 2..1090
Length: 363 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P49117	7.5e-144	100.0	Nuclear recepto...	Mus musculus
AAB33314	7.8e-144	100.0	type II zinc fi...	Mus sp.
BAE34041	1.9e-143	99.7	unnamed protein...	Mus musculus
EDL91388	2.9e-143	99.4	rCG56527, isofo...	Rattus norvegicus
EDL91386	3e-143	99.4	rCG56527, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
X66223	7.6e-17	31.5	mFLJ00318
AB093266	2.3e-09	27.1	mKIAA0832

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001723 156 177 PR00398 Steroid hormone receptor

IPR001723 177 193 PR00398 Steroid hormone receptor

IPR001723 252 267 PR00398 Steroid hormone receptor

IPR001723 309 326 PR00398 Steroid hormone receptor

HMMPfam IPR000536 158 346 PF00104 Nuclear hormone receptor

HMMSmart IPR000536 155 321 SM00430 Nuclear hormone receptor

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001723	156	177	PR00398	Steroid hormone receptor
IPR001723	177	193	PR00398	Steroid hormone receptor
IPR001723	252	267	PR00398	Steroid hormone receptor
IPR001723	309	326	PR00398	Steroid hormone receptor
HMMPfam	IPR000536	158	346	PF00104	Nuclear hormone receptor
HMMSmart	IPR000536	155	321	SM00430	Nuclear hormone receptor

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5425 bp
Genome contig ID	gi65504368f_92504803
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- CATGAGGTTTATACTATTAAAGTAAATTCAAGACT
Flanking genome sequence (115695 - 115744)	----+--------+--------+--------+--------+----* AGTATGTGTGCTGCTCATCTTTTTTTCCTCAAAACAGTCACATGTGGCCT

Gene/Protein Characteristic Table for mKIAA4145

Features of the cloned DNA sequence

Features of the protein sequence