ROUGE

Gene/Protein Characteristic Table for mFLJ00288

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220243
Description :	TBC1 domain family member 10.
Clone Name :	mic33003 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 4356 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2247 bp

Genome contig ID gi65527427f_3981610
PolyA signal sequence
(AATAAA,-10)
+----*----+----*----+----*----+----
AGACACAGTATACTTACATATAATAAATAAAATTT
Flanking genome sequence
(130580 - 130629)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGATTCAGAGTCCATAGTATGTTGCTTAGACAGGAGAGGAGGAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00288 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00288	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1120..2109
Length: 329 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD90168	7.9e-124	100.0	mFLJ00288 prote...	Mus musculus
AAH29773	1.3e-122	99.7	Tbc1d10a protei...	Mus musculus
P58802	1.7e-122	99.7	TBC1 domain fam...	Mus musculus
BAE24505	1.7e-122	99.7	unnamed protein...	Mus musculus
CAI25746	1.7e-122	99.7	TBC1 domain fam...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK131177	6.7e-13	44.3	mFLJ00332
AK129273	2.8e-10	31.4	mKIAA1055
AK220489	6e-09	37.0	mKIAA4104
BC018197	8.6e-09	31.5	mFLJ00006
AK220347	1.1e-08	30.7	mKIAA0603

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000195 1 153 PF00566 RabGAP/TBC

HMMSmart IPR000195 1 154 SM00164 RabGAP/TBC

ProfileScan IPR000195 4 125 PS50086 RabGAP/TBC

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	1	153	PF00566	RabGAP/TBC
HMMSmart	IPR000195	1	154	SM00164	RabGAP/TBC
ProfileScan	IPR000195	4	125	PS50086	RabGAP/TBC

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2247 bp
Genome contig ID	gi65527427f_3981610
PolyA signal sequence (AATAAA,-10)	+--------+--------+----*----+---- AGACACAGTATACTTACATATAATAAATAAAATTT
Flanking genome sequence (130580 - 130629)	----+--------+--------+--------+--------+----* AAAAAAAGATTCAGAGTCCATAGTATGTTGCTTAGACAGGAGAGGAGGAC

Gene/Protein Characteristic Table for mFLJ00288

Features of the cloned DNA sequence

Features of the protein sequence