Gene/Protein Characteristic Table for mKIAA1055

Length: 5906 bp

Restriction map

Length of 3'UTR	2964 bp
Genome contig ID	gi65519420r_89989350
PolyA signal sequence (AATAAA,-20)	+----*----+----*----+----*----+---- ACTTGTAAAGGAAGAAATAAACTAATTTTTATTAC
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* ATTCTGCCTCAAAAGGTAGGTGTAGTCATTTGTGACAGAAGCCTCTACGT

KIAA	Alignment based on:
KIAA1055	DNA sequence, AA sequence, Physical map

Coding region: 3..2942

Length: 979 aa

Entry Exp ID% Protein Source Q3U0J8 0 100.0 TBC1 domain fam... Mus musculus BAE33855 0 99.8 unnamed protein... Mus musculus Q9UPU7 0 88.8 TBC1 domain fam... Homo sapiens XP_001106607 0 88.3 similar to TBC1... Macaca mulatta EDL20908 0 100.0 TBC1 domain fam... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID BC018197 1.3e-21 34.4 mFLJ00006 AK173050 3.8e-16 33.0 mKIAA0882 AK172999 1.7e-14 33.9 mKIAA0676 AK122445 5.9e-11 24.2 mKIAA1108 AK220489 1e-10 25.6 mKIAA4104

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	49	152	PF00169	Pleckstrin-like
	IPR000195	675	894	PF00566	RabGAP/TBC
HMMSmart	IPR001849	49	155	SM00233	Pleckstrin-like
	IPR000195	675	895	SM00164	RabGAP/TBC
ProfileScan	IPR001849	48	153	PS50003	Pleckstrin-like
	IPR000195	678	869	PS50086	RabGAP/TBC

Method	From	To	amino acid sequence
SOSUI	839	861	DYTLITFNWFLVVFVDSVVSDIL