ROUGE

Gene/Protein Characteristic Table for mFLJ00268

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220311
Description :
Clone Name :	mtj02475 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 4327 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 198 bp

Genome contig ID gi65511124f_134546328
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
TTAGCAAATTGATGTCATTAAACTTCTTTAAACTT
Flanking genome sequence
(153337 - 153386)
----+----*----+----*----+----*----+----*----+----*
AAAATTAATTGTCAGTCCTCCCTAGAACCGTTATCACATTTAACTATAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00268 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00268	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1863..2240, 2381..2725
Length: 241 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD90388	1.2e-109	100.0	mFLJ00268 prote...	Mus musculus
ABV01370	4.5e-93	93.4	SCART2 splice v...	Mus musculus
ABV01369	4.9e-93	93.4	SCART2 splice v...	Mus musculus
EDM11910	1.8e-72	75.1	rCG47791, isofo...	Rattus norvegicus
EDM11911	1.8e-72	75.1	rCG47791, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129450	2.8e-10	40.3	mKIAA1822

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001190 25 41 PR00258 Speract/scavenger receptor

IPR001190 150 161 PR00258 Speract/scavenger receptor

IPR001190 165 175 PR00258 Speract/scavenger receptor

IPR001190 196 210 PR00258 Speract/scavenger receptor

IPR001190 219 231 PR00258 Speract/scavenger receptor

HMMPfam IPR001190 28 125 PF00530 Speract/scavenger receptor

IPR001190 134 231 PF00530 Speract/scavenger receptor

HMMSmart IPR001190 25 125 SM00202 Speract/scavenger receptor

IPR001190 131 231 SM00202 Speract/scavenger receptor

ProfileScan IPR001190 25 125 PS50287 Speract/scavenger receptor

IPR001190 131 231 PS50287 Speract/scavenger receptor

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001190	25	41	PR00258	Speract/scavenger receptor
IPR001190	150	161	PR00258	Speract/scavenger receptor
IPR001190	165	175	PR00258	Speract/scavenger receptor
IPR001190	196	210	PR00258	Speract/scavenger receptor
IPR001190	219	231	PR00258	Speract/scavenger receptor
HMMPfam	IPR001190	28	125	PF00530	Speract/scavenger receptor
IPR001190	134	231	PF00530	Speract/scavenger receptor
HMMSmart	IPR001190	25	125	SM00202	Speract/scavenger receptor
IPR001190	131	231	SM00202	Speract/scavenger receptor
ProfileScan	IPR001190	25	125	PS50287	Speract/scavenger receptor
IPR001190	131	231	PS50287	Speract/scavenger receptor

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	198 bp
Genome contig ID	gi65511124f_134546328
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTAGCAAATTGATGTCATTAAACTTCTTTAAACTT
Flanking genome sequence (153337 - 153386)	----+--------+--------+--------+--------+----* AAAATTAATTGTCAGTCCTCCCTAGAACCGTTATCACATTTAACTATAAA

Gene/Protein Characteristic Table for mFLJ00268

Features of the cloned DNA sequence

Features of the protein sequence