ROUGE |
Gene/Protein Characteristic Table for mFLJ00163 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220150 |
---|---|
Melanoma-associated antigen D1. | |
mph01789 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2607 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 210 bp Genome contig ID gi66880665r_89096135 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
TTGGTATCAGAAATAAATGTTGAAATTGCAAAGTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATTAAGTGTGCTTCTCATCTTTTGTGTATGCATATCCAGAGGGAGAGGG
KIAA Alignment based on: FLJ00163 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..2397
Length: 798 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |