| ROUGE |
Gene/Protein Characteristic Table for mKIAA1114 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK122449 |
|---|---|
| trophinin. melanoma antigen, family D, 3. trophinin-2. magphinin-alpha. magphinin-gamma. magphinin-beta 2. necdin and trophinin like. melanoma antigen, family D, 3-like. |
|
| mbg06405 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5434 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 223 bp Genome contig ID gi66880665r_144079706 PolyA signal sequence
(ATTAAA,-17) +----*----+----*----+----*----+----
TTTTGGTATTAGAGTTACATTAAATTTGCCAAAGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACCTGAGCTTATTCTGTCCTTTAATGTGACTGCATGTGATGTTTTGGGT
KIAA Alignment based on: KIAA1114 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 1..5211
Length: 1736 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |