| ROUGE |
Gene/Protein Characteristic Table for mKIAA1587 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | BC059039 |
|---|---|
| mfj49064 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3502 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 546 bp Genome contig ID gi66880665f_99621778 PolyA signal sequence
(AATAAA,-12) +----*----+----*----+----*----+----
AGTGTGTTGAAAAATAAAAGTGTAATAAATCAAATFlanking genome sequence
(103503 - 103552) ----+----*----+----*----+----*----+----*----+----*
AATGCTAATCCACTAATTTATTCAATAAATATATATTAAACTCCTCTCAT
KIAA Alignment based on: KIAA1587 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 152..2956
Length: 934 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |