ROUGE

Gene/Protein Characteristic Table for mFLJ00211

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131157
Description :	Melanoma-associated antigen G1.
Clone Name :	mbg20018 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5942 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5023 bp

Genome contig ID gi65511124r_58651098
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AATGTTACTTTTCTTCAATAAAGATTTCTTTTTTT
Flanking genome sequence
(99993 - 99944)
----+----*----+----*----+----*----+----*----+----*
AAAATGTTTTTAATTGAAATAAAATATCACTTTTCTTCCAAAATTTTTAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00211 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00211	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..919
Length: 305 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21407	1.9e-119	100.0	mFLJ00211 prote...	Mus musculus
Q9CPR8	6.8e-108	100.0	Melanoma-associ...	Mus musculus
BAB31133	2.2e-107	99.6	unnamed protein...	Mus musculus
AAH98730	2.3e-107	93.9	Ndnl2 protein [...	Rattus norvegicus
XP_219708	1.3e-106	93.5	similar to mage...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220150	1.3e-31	40.8	mFLJ00163
AK122449	5.9e-31	46.2	mKIAA1114
BC059039	6.3e-30	44.7	mKIAA1587

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002190 1 208 PF01454 MAGE protein

ProfileScan IPR002190 85 285 PS50838 MAGE protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002190	1	208	PF01454	MAGE protein
ProfileScan	IPR002190	85	285	PS50838	MAGE protein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5023 bp
Genome contig ID	gi65511124r_58651098
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AATGTTACTTTTCTTCAATAAAGATTTCTTTTTTT
Flanking genome sequence (99993 - 99944)	----+--------+--------+--------+--------+----* AAAATGTTTTTAATTGAAATAAAATATCACTTTTCTTCCAAAATTTTTAA

Gene/Protein Characteristic Table for mFLJ00211

Features of the cloned DNA sequence

Features of the protein sequence