ROUGE

Gene/Protein Characteristic Table for mFLJ00045

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131120
Description :	APG16L beta isoform. autophagy 16-like.
Clone Name :	mfj40199 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4162 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3219 bp

Genome contig ID gi65488608f_87472684
PolyA signal sequence
(AAGAAA,-30)
+----*----+----*----+----*----+----
TAAAGAAGAAATTCTGTTATATACTTTTCAAACTC
Flanking genome sequence
(136318 - 136367)
----+----*----+----*----+----*----+----*----+----*
CTTGCGTCTTGATTGTCTTTTCTGTCACATCCTTAAGTAAGGGGGAAAGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00045 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00045	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 68..883, 1828..2325, 2519..3043
Length: 612 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21370	4.3e-204	100.0	mFLJ00045 prote...	Mus musculus
BAE33214	2.4e-137	97.2	unnamed protein...	Mus musculus
BAC55090	4.9e-137	97.0	Apg16L alpha [M...	Mus musculus
Q8C0J2	1e-136	94.2	Autophagy-relat...	Mus musculus
BAC55091	2.2e-136	94.1	Apg16L beta [Mu...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK131109	6.7e-07	30.5	mFLJ00012
BC064045	0.0003	24.6	mKIAA4167
AK220340	0.00039	26.6	mKIAA0413

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001680 305 338 PD000018 WD-40 repeat

IPR001680 391 425 PD000018 WD-40 repeat

FPrintScan IPR001680 325 339 PR00320 WD-40 repeat

IPR001680 411 425 PR00320 WD-40 repeat

IPR001680 467 481 PR00320 WD-40 repeat

HMMPfam IPR001680 301 338 PF00400 WD-40 repeat

IPR001680 345 382 PF00400 WD-40 repeat

IPR001680 387 424 PF00400 WD-40 repeat

IPR001680 446 480 PF00400 WD-40 repeat

IPR001680 485 521 PF00400 WD-40 repeat

IPR001680 530 567 PF00400 WD-40 repeat

IPR001680 572 610 PF00400 WD-40 repeat

HMMSmart IPR001680 299 338 SM00320 WD-40 repeat

IPR001680 343 382 SM00320 WD-40 repeat

IPR001680 385 424 SM00320 WD-40 repeat

IPR001680 434 480 SM00320 WD-40 repeat

IPR001680 483 521 SM00320 WD-40 repeat

IPR001680 524 567 SM00320 WD-40 repeat

IPR001680 570 610 SM00320 WD-40 repeat

ProfileScan IPR001680 306 338 PS50082 WD-40 repeat

IPR001680 306 612 PS50294 WD-40 repeat

IPR001680 350 391 PS50082 WD-40 repeat

IPR001680 392 427 PS50082 WD-40 repeat

IPR001680 467 489 PS50082 WD-40 repeat

IPR001680 545 576 PS50082 WD-40 repeat

IPR001680 578 612 PS50082 WD-40 repeat

ScanRegExp IPR001680 325 339 PS00678 WD-40 repeat

IPR001680 411 425 PS00678 WD-40 repeat

IPR001680 467 481 PS00678 WD-40 repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	305	338	PD000018	WD-40 repeat
IPR001680	391	425	PD000018	WD-40 repeat
FPrintScan	IPR001680	325	339	PR00320	WD-40 repeat
IPR001680	411	425	PR00320	WD-40 repeat
IPR001680	467	481	PR00320	WD-40 repeat
HMMPfam	IPR001680	301	338	PF00400	WD-40 repeat
IPR001680	345	382	PF00400	WD-40 repeat
IPR001680	387	424	PF00400	WD-40 repeat
IPR001680	446	480	PF00400	WD-40 repeat
IPR001680	485	521	PF00400	WD-40 repeat
IPR001680	530	567	PF00400	WD-40 repeat
IPR001680	572	610	PF00400	WD-40 repeat
HMMSmart	IPR001680	299	338	SM00320	WD-40 repeat
IPR001680	343	382	SM00320	WD-40 repeat
IPR001680	385	424	SM00320	WD-40 repeat
IPR001680	434	480	SM00320	WD-40 repeat
IPR001680	483	521	SM00320	WD-40 repeat
IPR001680	524	567	SM00320	WD-40 repeat
IPR001680	570	610	SM00320	WD-40 repeat
ProfileScan	IPR001680	306	338	PS50082	WD-40 repeat
IPR001680	306	612	PS50294	WD-40 repeat
IPR001680	350	391	PS50082	WD-40 repeat
IPR001680	392	427	PS50082	WD-40 repeat
IPR001680	467	489	PS50082	WD-40 repeat
IPR001680	545	576	PS50082	WD-40 repeat
IPR001680	578	612	PS50082	WD-40 repeat
ScanRegExp	IPR001680	325	339	PS00678	WD-40 repeat
IPR001680	411	425	PS00678	WD-40 repeat
IPR001680	467	481	PS00678	WD-40 repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3219 bp
Genome contig ID	gi65488608f_87472684
PolyA signal sequence (AAGAAA,-30)	+--------+--------+----*----+---- TAAAGAAGAAATTCTGTTATATACTTTTCAAACTC
Flanking genome sequence (136318 - 136367)	----+--------+--------+--------+--------+----* CTTGCGTCTTGATTGTCTTTTCTGTCACATCCTTAAGTAAGGGGGAAAGG

Gene/Protein Characteristic Table for mFLJ00045

Features of the cloned DNA sequence

Features of the protein sequence