FLJ00045

Product ID	ORK04203
Accession No	AK024453
Clone name	as00045
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4208 bp) Predicted protein sequence (272 aa)
Source	Human spleen
Rouge ID	mFLJ00045 by Kazusa Mouse cDNA Project

Length: 4208 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Length: 272 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB15743	3.2e-90	100.0	FLJ00045 protei...	Homo sapiens
EAW71037	9.5e-88	100.0	ATG16 autophagy...	Homo sapiens
AAQ88549	1.4e-87	100.0	SSGL9393 [Homo ...	Homo sapiens
EAW71034	1.6e-87	100.0	ATG16 autophagy...	Homo sapiens
XP_001150056	1.6e-87	100.0	APG16 autophagy...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

No significant homologues

RT-PCR-ELISA

Experimental conditions

Primer_f	AAGACAGTGTTTGCAGGATCC
Primer_r	TTAGCAAGTCATCACGGGAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles