ROUGE |
Gene/Protein Characteristic Table for mFLJ00040 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131117 |
---|---|
mpm09196 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4355 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 980 bp Genome contig ID gi65511124f_30675670 PolyA signal sequence
(AGTAAA,-18) +----*----+----*----+----*----+----
ATGATGGAAAAGAAAACAGTAAACTTTGCCTCTCGFlanking genome sequence
(127126 - 127175) ----+----*----+----*----+----*----+----*----+----*
ATTGTGTCGTGCCATTTTTGTGTTTTGTTTTTGTTTTTTGTTTTTCGAGA
KIAA Alignment based on: FLJ00040 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 1340..2119, 2239..3375
Length: 638 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |