ROUGE

Gene/Protein Characteristic Table for mKIAA1785

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129440
Description :	fem-1 homolog c.
Clone Name :	mph01357 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3583 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1258 bp

Genome contig ID gi65551972r_46625579
PolyA signal sequence
(ATTAAA,-25)
+----*----+----*----+----*----+----
TTGTCACCCTATTAAACACAAGAGATTGCACAGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTCTGTCCCCTTAATGAAAGCGCCTCCTTCTGTTCTCCTCTTCCCCTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1785 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1785	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 472..2325
Length: 617 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDM14387	99.8	fem-1 homolog c...	Rattus norvegicus
BAC33691	99.7	unnamed protein...	Mus musculus
BAE28099	99.8	unnamed protein...	Mus musculus
A7MB89	99.4	Protein fem-1 h...	Bos taurus
XP_538557	99.2	similar to femi...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122272	2.6e-48	38.5	mKIAA0396
AK131166	5.6e-13	34.7	mFLJ00246
AB093299	5.4e-12	31.9	mKIAA1728
AK220375	4.3e-11	28.0	mKIAA1223
AK129471	6.7e-11	33.9	mKIAA1977

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 41 53 PR01415 Ankyrin

IPR002110 95 107 PR01415 Ankyrin

HMMPfam IPR002110 40 73 PF00023 Ankyrin

IPR002110 82 114 PF00023 Ankyrin

IPR002110 115 147 PF00023 Ankyrin

IPR002110 148 180 PF00023 Ankyrin

IPR002110 181 212 PF00023 Ankyrin

IPR002110 213 246 PF00023 Ankyrin

IPR002110 481 526 PF00023 Ankyrin

IPR002110 527 559 PF00023 Ankyrin

HMMSmart IPR002110 2 31 SM00248 Ankyrin

IPR002110 40 70 SM00248 Ankyrin

IPR002110 82 111 SM00248 Ankyrin

IPR002110 115 144 SM00248 Ankyrin

IPR002110 148 177 SM00248 Ankyrin

IPR002110 181 210 SM00248 Ankyrin

IPR002110 213 243 SM00248 Ankyrin

IPR002110 481 523 SM00248 Ankyrin

IPR002110 527 556 SM00248 Ankyrin

ProfileScan IPR002110 2 233 PS50297 Ankyrin

IPR002110 40 62 PS50088 Ankyrin

IPR002110 82 114 PS50088 Ankyrin

IPR002110 115 147 PS50088 Ankyrin

IPR002110 148 180 PS50088 Ankyrin

IPR002110 181 213 PS50088 Ankyrin

IPR001440 338 371 PS50005 TPR repeat

IPR002110 481 526 PS50088 Ankyrin

IPR002110 481 559 PS50297 Ankyrin

IPR002110 527 559 PS50088 Ankyrin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	41	53	PR01415	Ankyrin
IPR002110	95	107	PR01415	Ankyrin
HMMPfam	IPR002110	40	73	PF00023	Ankyrin
IPR002110	82	114	PF00023	Ankyrin
IPR002110	115	147	PF00023	Ankyrin
IPR002110	148	180	PF00023	Ankyrin
IPR002110	181	212	PF00023	Ankyrin
IPR002110	213	246	PF00023	Ankyrin
IPR002110	481	526	PF00023	Ankyrin
IPR002110	527	559	PF00023	Ankyrin
HMMSmart	IPR002110	2	31	SM00248	Ankyrin
IPR002110	40	70	SM00248	Ankyrin
IPR002110	82	111	SM00248	Ankyrin
IPR002110	115	144	SM00248	Ankyrin
IPR002110	148	177	SM00248	Ankyrin
IPR002110	181	210	SM00248	Ankyrin
IPR002110	213	243	SM00248	Ankyrin
IPR002110	481	523	SM00248	Ankyrin
IPR002110	527	556	SM00248	Ankyrin
ProfileScan	IPR002110	2	233	PS50297	Ankyrin
IPR002110	40	62	PS50088	Ankyrin
IPR002110	82	114	PS50088	Ankyrin
IPR002110	115	147	PS50088	Ankyrin
IPR002110	148	180	PS50088	Ankyrin
IPR002110	181	213	PS50088	Ankyrin
IPR001440	338	371	PS50005	TPR repeat
IPR002110	481	526	PS50088	Ankyrin
IPR002110	481	559	PS50297	Ankyrin
IPR002110	527	559	PS50088	Ankyrin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1258 bp
Genome contig ID	gi65551972r_46625579
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- TTGTCACCCTATTAAACACAAGAGATTGCACAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCTGTCCCCTTAATGAAAGCGCCTCCTTCTGTTCTCCTCTTCCCCTC

Gene/Protein Characteristic Table for mKIAA1785

Features of the cloned DNA sequence

Features of the protein sequence