ROUGE

Gene/Protein Characteristic Table for mKIAA0957

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173070
Description :	ankyrin repeat domain 6. diversin.
Clone Name :	mfj01140 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4484 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2078 bp

Genome contig ID gi65493515r_32982829
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TGTCTCCTATATGCATTAAATGTTGTTTTCAGTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGCTAGTATTCTACTTTTTAGTCATTAGTTCTGCACATTGCACTCTAGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0957 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0957	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 265..2406
Length: 713 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q69ZU8	0	100.0	Ankyrin repeat ...	Mus musculus
EDL98570	0	95.1	similar to anky...	Rattus norvegicus
XP_001500798	1.8e-197	83.7	ankyrin repeat ...	Equus caballus
AAH42173	9.9e-197	83.4	Ankyrin repeat ...	Homo sapiens
XP_001096783	1.4e-196	83.4	ankyrin repeat ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220375	2.8e-11	27.9	mKIAA1223
AK122478	6.5e-11	31.7	mKIAA1250
AK131166	1.7e-09	28.6	mFLJ00246
AK129327	2.9e-08	28.7	mKIAA1306
AK129094	4.5e-08	35.4	mKIAA0229

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 43 55 PR01415 Ankyrin

IPR002110 220 232 PR01415 Ankyrin

HMMPfam IPR002110 42 74 PF00023 Ankyrin

IPR002110 75 107 PF00023 Ankyrin

IPR002110 108 140 PF00023 Ankyrin

IPR002110 141 173 PF00023 Ankyrin

IPR002110 174 206 PF00023 Ankyrin

IPR002110 207 239 PF00023 Ankyrin

IPR002110 240 270 PF00023 Ankyrin

HMMSmart IPR002110 10 39 SM00248 Ankyrin

IPR002110 42 71 SM00248 Ankyrin

IPR002110 75 104 SM00248 Ankyrin

IPR002110 108 137 SM00248 Ankyrin

IPR002110 141 170 SM00248 Ankyrin

IPR002110 174 203 SM00248 Ankyrin

IPR002110 207 236 SM00248 Ankyrin

IPR002110 240 269 SM00248 Ankyrin

ProfileScan IPR002110 42 74 PS50088 Ankyrin

IPR002110 42 260 PS50297 Ankyrin

IPR002110 75 107 PS50088 Ankyrin

IPR002110 108 140 PS50088 Ankyrin

IPR002110 141 173 PS50088 Ankyrin

IPR002110 174 206 PS50088 Ankyrin

IPR002110 207 239 PS50088 Ankyrin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	43	55	PR01415	Ankyrin
IPR002110	220	232	PR01415	Ankyrin
HMMPfam	IPR002110	42	74	PF00023	Ankyrin
IPR002110	75	107	PF00023	Ankyrin
IPR002110	108	140	PF00023	Ankyrin
IPR002110	141	173	PF00023	Ankyrin
IPR002110	174	206	PF00023	Ankyrin
IPR002110	207	239	PF00023	Ankyrin
IPR002110	240	270	PF00023	Ankyrin
HMMSmart	IPR002110	10	39	SM00248	Ankyrin
IPR002110	42	71	SM00248	Ankyrin
IPR002110	75	104	SM00248	Ankyrin
IPR002110	108	137	SM00248	Ankyrin
IPR002110	141	170	SM00248	Ankyrin
IPR002110	174	203	SM00248	Ankyrin
IPR002110	207	236	SM00248	Ankyrin
IPR002110	240	269	SM00248	Ankyrin
ProfileScan	IPR002110	42	74	PS50088	Ankyrin
IPR002110	42	260	PS50297	Ankyrin
IPR002110	75	107	PS50088	Ankyrin
IPR002110	108	140	PS50088	Ankyrin
IPR002110	141	173	PS50088	Ankyrin
IPR002110	174	206	PS50088	Ankyrin
IPR002110	207	239	PS50088	Ankyrin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2078 bp
Genome contig ID	gi65493515r_32982829
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TGTCTCCTATATGCATTAAATGTTGTTTTCAGTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGCTAGTATTCTACTTTTTAGTCATTAGTTCTGCACATTGCACTCTAGAG

Gene/Protein Characteristic Table for mKIAA0957

Features of the cloned DNA sequence

Features of the protein sequence