ROUGE |
Gene/Protein Characteristic Table for mFLJ00018 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131110 |
---|---|
common-site lymphoma/leukemia GEF. | |
mpm05346 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4880 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 200 bp Genome contig ID gi65511124r_23661413 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TCATGGTTATTTTGTTAATTAATTTTATGAAACGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TGTGTGTTTTGCCTTTCTTGAGGTAATGGGAAATGGGCAGACACCATGAA
KIAA Alignment based on: FLJ00018 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 562..4680
Length: 1372 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |