ROUGE

Gene/Protein Characteristic Table for mKIAA0362

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122259
Description :	Guanine nucleotide exchange factor DBS.
Clone Name :	mbe05003 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4061 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1638 bp

Genome contig ID gi65515060f_12279395
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AGAATGGTAATAAAATAAAAAACGTGCAAAGACTC
Flanking genome sequence
(119748 - 119797)
----+----*----+----*----+----*----+----*----+----*
AGTAGCATTTCTGGTTATGTGTTATGCGGGAAGAATCGTGGGACATAACT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0362 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0362	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2423
Length: 806 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAX11890	88.2	MCF.2 cell line...	Homo sapiens
EDL22105	94.7	mcf.2 transform...	Mus musculus
AAH58622	96.3	Mcf.2 transform...	Mus musculus
EDL22107	96.3	mcf.2 transform...	Mus musculus
BAE27798	96.1	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK131125	2.2e-14	25.9	mFLJ00068
AK131110	1.4e-12	27.0	mFLJ00018
AK220313	7.8e-10	26.7	mFLJ00298
AK122468	4.7e-09	27.4	mKIAA1209
AK122280	3.5e-08	25.6	mKIAA0424

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001452 729 744 PR00452 SH3

IPR001452 759 771 PR00452 SH3

HMMPfam IPR000219 268 443 PF00621 DH

IPR001849 463 578 PF00169 Pleckstrin-like

IPR001452 715 771 PF00018 SH3

IPR011511 716 771 PF07653 Variant SH3

HMMSmart IPR002017 4 87 SM00150 Spectrin repeat

IPR000219 268 443 SM00325 DH

IPR001849 463 580 SM00233 Pleckstrin-like

IPR001452 715 772 SM00326 SH3

ProfileScan IPR000219 264 444 PS50010 DH

IPR001849 462 578 PS50003 Pleckstrin-like

IPR001452 712 773 PS50002 SH3

ScanRegExp IPR001331 393 418 PS00741 Guanine-nucleotide dissociation stimulator

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001452	729	744	PR00452	SH3
IPR001452	759	771	PR00452	SH3
HMMPfam	IPR000219	268	443	PF00621	DH
IPR001849	463	578	PF00169	Pleckstrin-like
IPR001452	715	771	PF00018	SH3
IPR011511	716	771	PF07653	Variant SH3
HMMSmart	IPR002017	4	87	SM00150	Spectrin repeat
IPR000219	268	443	SM00325	DH
IPR001849	463	580	SM00233	Pleckstrin-like
IPR001452	715	772	SM00326	SH3
ProfileScan	IPR000219	264	444	PS50010	DH
IPR001849	462	578	PS50003	Pleckstrin-like
IPR001452	712	773	PS50002	SH3
ScanRegExp	IPR001331	393	418	PS00741	Guanine-nucleotide dissociation stimulator

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1638 bp
Genome contig ID	gi65515060f_12279395
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AGAATGGTAATAAAATAAAAAACGTGCAAAGACTC
Flanking genome sequence (119748 - 119797)	----+--------+--------+--------+--------+----* AGTAGCATTTCTGGTTATGTGTTATGCGGGAAGAATCGTGGGACATAACT

Gene/Protein Characteristic Table for mKIAA0362

Features of the cloned DNA sequence

Features of the protein sequence