Gene/Protein Characteristic Table for mFLJ00298

Length: 5232 bp

Restriction map

Length of 3'UTR	3498 bp
Genome contig ID	gi65540054f_55144649
PolyA signal sequence (ATTAAA,-17)	+----*----+----*----+----*----+---- GTCATTTTGTATTTGTATATTAAAATTAATTTGCC
Flanking genome sequence (155045 - 155094)	----+----*----+----*----+----*----+----*----+----* AAGCTGGTTCTAGTGATGCATCTCCATAGTAAAAGAAGATAGACACATTA

KIAA	Alignment based on:
FLJ00298	DNA sequence, AA sequence, Physical map

Coding region: 1..1734

Length: 577 aa

Entry Exp ID% Protein Source BAD90389 0 100.0 mFLJ00298 prote... Mus musculus Q5DU57 0 100.0 Spermatogenesis... Mus musculus AAI45286 0 100.0 Spata13 protein... Mus musculus AAI38456 0 100.0 Spata13 protein... Mus musculus XP_906995 0 100.0 spermatogenesis... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122280 1.4e-101 63.0 mKIAA0424 AK122448 9.7e-52 62.2 mKIAA1112 AK173168 4e-24 33.8 mKIAA1415 AK131110 1.3e-13 29.2 mFLJ00018 AK122259 2.6e-12 26.7 mKIAA0362

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	77	126	PD000066	SH3
FPrintScan	IPR001452	89	104	PR00452	SH3
	IPR001452	106	115	PR00452	SH3
	IPR001452	117	129	PR00452	SH3
HMMPfam	IPR001452	75	129	PF00018	SH3
	IPR011511	76	129	PF07653	Variant SH3
	IPR000219	169	348	PF00621	DH
	IPR001849	381	486	PF00169	Pleckstrin-like
HMMSmart	IPR001452	75	130	SM00326	SH3
	IPR000219	169	348	SM00325	DH
	IPR001849	381	488	SM00233	Pleckstrin-like
ProfileScan	IPR001452	79	131	PS50002	SH3
	IPR000219	165	349	PS50010	DH
	IPR001849	380	486	PS50003	Pleckstrin-like
ScanRegExp	IPR001331	297	322	PS00741	Guanine-nucleotide dissociation stimulator

Method	From	To	amino acid sequence
-	-	-	-